Top
IDB6Ng01-034H03
Information of forward sequence (DDBJ: DH863198)
Chromosome 12 position(base) 68802561 - 68803606 strand -
Alignment
seq1: chr12_68802561_68803606
seq2: B6Ng01-034H03.b_49_1073 (reverse)

seq1  AGTCTTACTTTTCTTGTGTTGGGATATCCAGCACTTGCTGTTGTGGGGGA  50
      |||||||||    || || | ||| || ||||| |||||||||| |||||
seq2  AGTCTTACT----TTCTGGTTGGA-ATTCAGCA-TTGCTGTTGT-GGGGA  43

seq1  ACTAGTTTCCAATGATGCCATGAAGCTTTGGTTTCTGTTGGTAAGGTTCT  100
      |||  | | |||||||||||||||||||  | |||||||||||||| |||
seq2  ACT--TATTCAATGATGCCATGAAGCTT--GGTTCTGTTGGTAAGG-TCT  88

seq1  TGTGCTTGCCTTTCACTAACTGGTAATATCTGGTGTTAGTTGGTCTTGCT  150
      |||   ||||||||||||||||||||||||||||||||||  ||| ||||
seq2  TGTAGCTGCCTTTCACTAACTGGTAATATCTGGTGTTAGT--GTC-TGCT  135

seq1  GTCTCTGACTGGAGCCTGTCCTTCCTGTGGGGCCTCTAAGCCTATGTCAG  200
      |||||||||| |||||||||| ||||||  || ||||||| |||||||||
seq2  GTCTCTGACT-GAGCCTGTCC-TCCTGT--GGACTCTAAG-CTATGTCAG  180

seq1  CACTTCTAGGAGACAAGCTCTCCCCTGACAGGACCATTACACAAAGGGCT  250
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  CACTTCTAGGAGACAAGCTCT-CCCTGACAGGACCATTACACAAAGGGCT  229

seq1  GTGGAACAGCCCCAGCTCCTGGGTAGAGGTGGAGGCTGGAAGGACATTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAACAGCCCCAGCTCCTGGGTAGAGGTGGAGGCTGGAAGGACATTGT  279

seq1  CCCAACTGCTCCACAGCTCCTCTGGCCTGTGTGCTTCTGGCTGGTCCCTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAACTGCTCCACAGCTCCTCTGGCCTGTGTGCTTCTGGCTGGTCCCTC  329

seq1  CTTCGATAGTCATCGGAGAGAAAATGGCAATCTCACCTCCAAGCCTATCG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCGATAGTCATCGGAGAGAAAATGGCAATCTCACCTCCAAGCCTATCG  379

seq1  TCAGTTCTTACTTTACAACAGTTTATGTCTAGAATAATGATTAATATTTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTTCTTACTTTACAACAGTTTATGTCTAGAATAATGATTAATATTTT  429

seq1  CTAGTCACAGAGTTTGATATTTATTGAATAAATAATAGTATTTTATACAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGTCACAGAGTTTGATATTTATTGAATAAATAATAGTATTTTATACAC  479

seq1  AAAGAATATTACTGTCTCTTGAATTAATTAATAATTGACATTTACAATGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAATATTACTGTCTCTTGAATTAATTAATAATTGACATTTACAATGA  529

seq1  AAATGTTAAGCTGAAAGATTGGAGATCTGGTCAGTTTTGGAAGTCTGAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGTTAAGCTGAAAGATTGGAGATCTGGTCAGTTTTGGAAGTCTGAAA  579

seq1  AAATGTCATCTTAATTCCTGATATTTTTTTGATCAGTGAACATTACAATA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGTCATCTTAATTCCTGATATTTTTTTGATCAGTGAACATTACAATA  629

seq1  ACATTTGTGAAAATAAGACAAAAGAACACCCAAGCCATCTTGTCTCTAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTGTGAAAATAAGACAAAAGAACACCCAAGCCATCTTGTCTCTAAA  679

seq1  GAAATAGAAATGAATTTTCTCCCAGATTGTCACTTAATCTCTCTTAACAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATAGAAATGAATTTTCTCCCAGATTGTCACTTAATCTCTCTTAACAT  729

seq1  AAATACAAGGAAAACAAATAATTTACATCCATGATGATATTCAATAAGAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATACAAGGAAAACAAATAATTTACATCCATGATGATATTCAATAAGAT  779

seq1  ATATTATGTTGAATGTCTGACTTTTTTCTAAAATAATTATAAATAGGTCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTATGTTGAATGTCTGACTTTTTTCTAAAATAATTATAAATAGGTCC  829

seq1  TTTTATTCTGATTTGCAATTTATATACTTTACACCTTAATGTTTGTATCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTATTCTGATTTGCAATTTATATACTTTACACCTTAATGTTTGTATCA  879

seq1  TTAGTCCTCACAAGTTTTAGGTTATTTCATCTACTGCAATTTCCTGTAAC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTCCTCACAAGTTTTAGGTTATTTCATCTACTGCAATTTCCTGTAAC  929

seq1  AGGCTTTTCATTATCAGATAAAGGCTGTCTGAAGAGAAGTTTGATTGTAA  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTTTTCATTATCAGATAAAGGCTGTCTGAAGAGAAGTTTGATTGTAA  979

seq1  GGCACAGGAATTTTACTTGAGCTGTGAATGATGGAGAGCTGAATTC  1046
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCACAGGAATTTTACTTGAGCTGTGAATGATGGAGAGCTGAATTC  1025

Information of reverse sequence (DDBJ: DH863199)
Chromosome 1 position(base) 179874135 - 179874223 strand -
Alignment
seq1: chr1_179874135_179874223
seq2: B6Ng01-034H03.g_126_195 (reverse)

seq1  AGAAGAAGAAGAGGAGGAAGAAGAGAAGAAGAGGAGGAAGAGGGGGAAGA  50
      |||||| ||||||||||||||  |||||||||                 |
seq2  AGAAGAGGAAGAGGAGGAAGA--AGAAGAAGA-----------------A  31

seq1  GGAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA  89
      | |||||||||||||||||||||||||||||||||||||
seq2  GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA  70