Top
IDB6Ng01-345J13
Information of forward sequence (DDBJ: GA127742)
Chromosome 16 position(base) 89542852 - 89544033 strand +
Alignment
seq1: chr16_89542852_89544033
seq2: B6Ng01-345J13.b_46_1127

seq1  GAATTCACACATCCACACTGAGGAACCCTGACCCCAGTTGGTTTTGATTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACACATCCACACTGAGGAACCCTGACCCCAGTTGGTTTTGATTG  50

seq1  GTAAATAAAGATGCTTGTGGCCAAAGACTGGGCAGGGAGACAGAGGAGGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAATAAAGATGCTTGTGGCCAAAGACTGGGCAGGGAGACAGAGGAGGG  100

seq1  ACATTAGGGTGCCCGGGCAAAAGACTGAAAAAGAGCAGGAAGAGAATCAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTAGGGTGCCCGGGCAAAAGACTGAAAAAGAGCAGGAAGAGAATCAG  150

seq1  GCACCATGCTGGAAAAGGAGTAGATGCCACGCCTGAGAGATGCCAGAGAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACCATGCTGGAAAAGGAGTAGATGCCACGCCTGAGAGATGCCAGAGAA  200

seq1  CATATCTGTCATGTAAGTGCTGGGGAACTCAGCCCAAAAGGGCTGCAGGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATATCTGTCATGTAAGTGCTGGGGAACTCAGCCCAAAAGGGCTGCAGGT  250

seq1  CTGGGTCGAGGCAGCCAAGATGGAATGTAGGTTTTAATAAGTAATAACTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGTCGAGGCAGCCAAGATGGAATGTAGGTTTTAATAAGTAATAACTT  300

seq1  AGGGATATTGGATGGGAGGGTGTTAGCCACGTGGAGATTTGGAAGTAACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGATATTGGATGGGAGGGTGTTAGCCACGTGGAGATTTGGAAGTAACC  350

seq1  CTGCCTTTGAGCTGTTTAAGGAATATTAAAATATAAAAGGTGTGTGTGTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCTTTGAGCTGTTTAAGGAATATTAAAATATAAAAGGTGTGTGTGTG  400

seq1  TATGTGCGTGTGCCTTTCATTCGAGAACCCAGAACATTGGGGCAGGAAGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTGCGTGTGCCTTTCATTCGAGAACCCAGAACATTGGGGCAGGAAGC  450

seq1  GAGGAGTGCTACCACTGCCACTGCCGCTGCCACCGCCACCGCCACCGCCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAGTGCTACCACTGCCACTGCCGCTGCCACCGCCACCGCCACCGCCA  500

seq1  GCACTTCTGCCACTGCCACAGCCACGGCCAGGGTCGATTTGAGTAGGATT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTTCTGCCACTGCCACAGCCACGGCCAGGGTCGATTTGAGTAGGATT  550

seq1  TATTGGGAAATGCTATAATTACCAAAGTAAAGAGTCGATAGATAATAGTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGGGAAATGCTATAATTACCAAAGTAAAGAGTCGATAGATAATAGTG  600

seq1  AATAAAGGTGGAGAGATATCATATCAGTTAGAAATCTAGCGTAACTCAAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAAGGTGGAGAGATATCATATCAGTTAGAAATCTAGCGTAACTCAAA  650

seq1  GCAGACAATCAAAACTACATCAGTGGGGTAGCTCCTGGAAGCCAGGATAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGACAATCAAAACTACATCAGTGGGGTAGCTCCTGGAAGCCAGGATAG  700

seq1  AGAAACCAGAAGCGGTGAATTGTGTTCAGTCCTCTGACCTTCACTATCTA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAACCAGAAGCGGTGAATTGTGTTCAGTCCTCTGACCTTCACTATCTA  750

seq1  GCTCTGGGTGCACCCTGGATCTTGAGGAGATTTGCATGACGCCAGGACCA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTGGGTGCACCCTGGATCTTGAGGAGATTTGCATGACGCCAGGACCA  800

seq1  TCCAACCTCTCCAAGGGGGCCTGTGGAGGCCCCAGAAATATCCAGTTTGA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAACCTCTCCAAGGGGGCCTGTGGAGGCCCCAGAAATATCCAGTTTGA  850

seq1  ACCCCTCCAGCACCAACCTCTTGCCAGTCGGGTTCCCTGAGGCACAGCCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCCTCCAGCACCAACCTCTTGCCAGTCGGGTTCCCTGAGGCACAGCCA  900

seq1  GCAAAGTTGAGTTGTGCAGGTTCTCCTGACCTCTATTGTCTGTCTCTGCC  950
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  GCAAAGTTGAG-TGTGCAGGTTCTCCTGACCTCTATTGTCTGTCTCTGCC  949

seq1  TCCCCTGAAGTCCTGAGGGCCTTGTGGAATCCCAAGAGCATCCATTTTCC  1000
      |||||||||||||||||||||||||||||| |||||||||||   |||||
seq2  TCCCCTGAAGTCCTGAGGGCCTTGTGGAAT-CCAAGAGCATC--ATTTCC  996

seq1  CACTTCCACGGATACCTGTGGGTGTATGAATGTTTGAATGTGTACTTACA  1050
      ||||||||||||||||||||||||||||||||||||||| ||||  ||  
seq2  CACTTCCACGGATACCTGTGGGTGTATGAATGTTTGAAT-TGTAACTAAC  1045

seq1  GAGACGGTCTG-ATACGTG-AAAAATCCATCAATG-TAATCCAACAGAAA  1097
      ||||| ||||| ||||||| |||||||  || ||| ||            
seq2  GAGAC-GTCTGAATACGTGAAAAAATCATTCCATGTTA------------  1082

seq1  AACAAACTGAAAGAAAAAGAAAAACACAAACATCTTACTAGATGCTGAAA  1147
                                                        
seq2  --------------------------------------------------  1082

seq1  AATCCTTTGACAAAATCCAACACCCCTCCATGTTA  1182
                                         
seq2  -----------------------------------  1082

Information of reverse sequence (DDBJ: GA127743)
Chromosome 12 position(base) 109293589 - 109293658 strand -
Alignment
seq1: chr12_109293589_109293658
seq2: B6Ng01-345J13.g_72_119 (reverse)

seq1  TCACACACACACACACACACACACACACACTTACACACACAGCAGGCAGA  50
      ||||||||||||||||||||||||||||||                   |
seq2  TCACACACACACACACACACACACACACAC-------------------A  31

seq1  CACACAGAGAGACACTCACA  70
      ||||||   |||||||||||
seq2  CACACA---AGACACTCACA  48