Top
IDMSMg01-083C21
Information of forward sequence (DDBJ: AG303373)
Chromosome 12 position(base) 51546609 - 51547235 strand -
Alignment
seq1: chr12_51546609_51547235
seq2: MSMg01-083C21.T7_46_697 (reverse)

seq1  TCAGCTAAGTTCTTTGTTTATGCTTACAAAGGCAGATGATCCTGAGTTCA  50
      ||||||||||| |||||||||||| ||||||||||||||| |||| ||||
seq2  TCAGCTAAGTTTTTTGTTTATGCTAACAAAGGCAGATGAT-CTGATTTCA  49

seq1  GGGTCAGCCTAGGGCAGAGGAAAGTTAGGCTTTTCTAAGTTTTGTCCTGA  100
      |||||| ||||||| ||||||||||||||||||| |||||||||||||||
seq2  GGGTCAACCTAGGGTAGAGGAAAGTTAGGCTTTTATAAGTTTTGTCCTGA  99

seq1  GGCAGGGGGCATGATTGGGATATAAAGTGAATAAAAGAATTTCAACAGAA  150
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  GGCAGGGGGCATGATTGGGATATAAAGTGAATAAAAGAATTTCACCAGAA  149

seq1  TTGTTCACATATCTTGAAAGGACAATGGTCAGCTTCATACAGAAATACAA  200
      || |||||| ||||||||||||||||||||||||||||| ||||||||||
seq2  TTCTTCACAGATCTTGAAAGGACAATGGTCAGCTTCATATAGAAATACAA  199

seq1  AATCACATAATAACTAAAAC--AAAACAATAAGAAACTACTGAACTAAAC  248
      |||||||| ||||||| |||  ||||||||||||||||||||||||||||
seq2  AATCACATGATAACTATAACAAAAAACAATAAGAAACTACTGAACTAAAC  249

seq1  AAAAGAACTCCTGAAGGTATTACCATCCCTACTTTCAAGTTATATATGAA  298
       |||||| |||||||||||||||||| ||||||||| |||||||||||||
seq2  TAAAGAATTCCTGAAGGTATTACCATTCCTACTTTCGAGTTATATATGAA  299

seq1  GATAAATAAGCTATGAAAGTTGTCGTAGATGAGGAACAGCCAAAGAACTC  348
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  GATAAATAAGCTATGAAAGTTGTCGTAGATGAGAAACAGCCAAAGAACTC  349

seq1  ATAGAAGGTTTAGAATGGAGTGGGGCAGAA--------------------  378
      |||||||||||||||||||||||||||| |                    
seq2  ATAGAAGGTTTAGAATGGAGTGGGGCAGGAGTTTAAAGGTTCACTGGGCA  399

seq1  ---AACA----AAGAGCAGAAAACAAAGCCAGGTGAACTGTAAGGACCTC  421
         | ||    || ||||||||||||||||||||||||||||||||||||
seq2  GTCACCAGCTTAACAGCAGAAAACAAAGCCAGGTGAACTGTAAGGACCTC  449

seq1  TACAGCTTCATCCTCAGTATGGCAACCATTTTGCCCACATAGCGATATTC  471
      ||||||||||||| ||||||||||||||  ||| ||||||||||||||||
seq2  TACAGCTTCATCCCCAGTATGGCAACCA--TTGACCACATAGCGATATTC  497

seq1  TTAAATTTAAGAAAGTACAGGATCCCCTTCTTCAGACATAAGTTCAAGTT  521
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAATTTAAGAAAGTACAGGATCCCCTTCTTCAGACATAAGTTCAAGTT  547

seq1  CTCTATGGGCACAAGTGACAGTGGATACAACGTTGGGAAGTACAGAACAT  571
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  CTCTATGGGCACAAGTGACAGTGGATACAACGTTGGGAAGCACAGAACAT  597

seq1  TGCTTTCCAGGTTTCAGAAAGTTGTGCTGTACTGCACCGCACCAGAGAAG  621
      ||||||||||| |||||||||||||||||||||||||||| |||||||||
seq2  TGCTTTCCAGG-TTCAGAAAGTTGTGCTGTACTGCACCGCGCCAGAGAAG  646

seq1  GAATTC  627
      ||||||
seq2  GAATTC  652

Information of reverse sequence (DDBJ: AG303374)
Chromosome 9 position(base) 59031751 - 59031932 strand -
Alignment
seq1: chr9_59031751_59031932
seq2: MSMg01-083C21.TJ_77_247 (reverse)

seq1  AGAGAGAGGAACAGAGAGGCAGAGATTGAGACACAGAAAGAGAGTTTCAG  50
      ||||||||||| |||||   |||||   ||    |  ||||| |    ||
seq2  AGAGAGAGGAAAAGAGA---AGAGAAGAAGGTGGAAGAAGAGGGGGGAAG  47

seq1  TCTCTCTGCCCCGTCTTTCTGTCTGTTCCTGTGCATGTGTGTGTGTGTCT  100
             |                      | | | | | |   | |   
seq2  GGGAAAAG---------------------GGAGGAGGGGAGAAAGGGGGA  76

seq1  GTCTGTCTGTCTCCTGTGTGTATGTGTATGAGAGAGAAACAG-AGTCTGC  149
          |            |   | | | | || | ||| |||| | |||  
seq2  AGAAG------------GGAAAAGAGGAAGAAAAAGACACAGAAATCT--  112

seq1  CTCTCTCTCACTCTCTCTCTCTCTCTCTCTCTG-----------------  182
      ||||||||| ||||||||||||||||||||||                  
seq2  CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT  162

seq1  ---------  182
               
seq2  CTCTCTCTG  171