Top
IDMSMg01-141C07
Information of forward sequence (DDBJ: AG346096)
Chromosome 3 position(base) 155128341 - 155128470 strand -
Alignment
seq1: chr3_155128341_155128470
seq2: MSMg01-141C07.T7_930_1061 (reverse)

seq1  TCTCTTCTTCTTCTTTCCTTCTTTTTTCTTTCCTTCTTT--CTTTCCTTC  48
      |||||||||||  |||| || |||||| |||   |||||  |||| | ||
seq2  TCTCTTCTTCT--TTTCTTTTTTTTTTTTTTTTCTCTTTCCCTTTTC-TC  47

seq1  CTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTC---CTTCCTCCCTT  95
      | || ||   || || |||  ||| || ||| ||||   |||| ||||||
seq2  CCTCTTTTTCTCTTTTCTTTTTTCTTTTCTTTCTTCTCTCTTCTTCCCTT  97

seq1  CCTTCCTTCCTTTC-CTCCCTCCCTCCCTCCCTCCC  130
      |||||||||||  | | ||||||| ||||| |||||
seq2  CCTTCCTTCCTCNCTCCCCCTCCC-CCCTCTCTCCC  132

Information of reverse sequence (DDBJ: AG346097)
Chromosome 16 position(base) 12214201 - 12215132 strand -
Alignment
seq1: chr16_12214201_12215132
seq2: MSMg01-141C07.TJ_104_1049 (reverse)

seq1  TCCC-AAGTGCTT-GGATTACAGGTAT---ACACAA-CCACG-CCTGGCT  43
      |||| |||||||| ||||||||||  |   |||||| ||||| || ||||
seq2  TCCCAAAGTGCTTGGGATTACAGGGGTGTAACACAACCCACGCCCGGGCT  50

seq1  TTC-AGCATACACTTTA-TTCTATATGACACTATATGACAGGAGCAGACA  91
      ||| ||||||||| ||| || |||||||| ||||||||||||||| ||||
seq2  TTCAAGCATACACCTTATTTTTATATGACCCTATATGACAGGAGCGGACA  100

seq1  CTTCCTTGTTATCTACTTCTGTATATAATTCTGCAATTGCA-CAATAGCC  140
      ||||| |||| ||||||||   |||||||||||||| |||| ||||||||
seq2  CTTCCCTGTTTTCTACTTCGTAATATAATTCTGCAA-TGCACCAATAGCC  149

seq1  TAGCATAATATGAACATGTTTGCACAATCGATATCTAGAGGTTTGTCTTT  190
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCATAATATGAACATGTTTGCACAATCGATATCTAGAGGTTTGTCTTT  199

seq1  GGGTTGCAGTATCTCTGTTAAGAATGCTGCCTTCTTCTTTTATGAC----  236
      ||||||||||||||||||||||||||||||||||||||||||||||    
seq2  GGGTTGCAGTATCTCTGTTAAGAATGCTGCCTTCTTCTTTTATGACTCTG  249

seq1  TCTATCTTTAAAGTTTTAGTCTATATCATTGATTTCCAAAAATTTGGTTC  286
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATCTTTAAAGTTTTAGTCTATATCATTGATTTCCAAAAATTTGGTTC  299

seq1  TCATTTGTTTCCCTGTAGTCTTCTTTATGTTTCTGGTATTTGTGTGTTAG  336
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  TCATTTGTTTCCCTGTAGTCTTCTTTATGTTTCTGGTATTTGTGTGCTAG  349

seq1  TCTTCTTGGATCTGGAGTGTATAGTTTCCATAATATTTTTCATAATGGCT  386
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  TCTTCTTGGATCTGGAGTGTATAGTTTCCATAATATTTTTCATAATGGTT  399

seq1  CATCATTAATTAATTCATAATCAATCGTTTTCTAGTTCTGTCTTTCTGTT  436
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCATTAATTAATTCATAATCAATCGTTTTCTAGTTCTGTCTTTCTGTT  449

seq1  TCTCCTCAGCTGCATCCTGCAGCTCAATGGCACTATTTTTCACAGTTTTA  486
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  TCTCCTCAGCTGCATCCTGCAGCTCAATGGCACTATTCTTCACAGTTTTA  499

seq1  TTTTTAAAAACCATTTTTATGGGACAGGAAGAGGGATAAAAAGGTGAAGG  536
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTAAAAACCATTTTTATGGGACAGGAAGAGGGATAAAAAGGTGAAGG  549

seq1  TACTTGCCACATGTGTAATGACCTGGGCTTGTTCCTCCTAAACCCACTGG  586
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTGCCACATGTGTAATGACCTGGGCTTGTTCCTCCTAAACCCACTGG  599

seq1  TAGAATGAGAGAAGCTGTCTCTTCTAGGTGGGTTCTGAGTGCACACAGTA  636
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAATGAGAGAAGCTGTCTCTTCTAGGTGGGTTCTGAGTGCACACAGTA  649

seq1  AATAAATGAATCAATGTCATAAAAATCCATCCAATACTTGGGACTAAGCC  686
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAATGAATCAATGTCATAAAAATCCATCCAATACTTGGGACTAAGCC  699

seq1  CACCAGGCAAGAGACTCATGCTCAGGCCACTTCCTCAGCCCCTCATTGGT  736
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCAGGCAAGAGACTCATGCTCAGGCCACTTCCTCAGCCCCTCATTGGT  749

seq1  TCATTTTAATTGATTCTATTACTCTGGTTTTCAGATCACCAGTATTTACT  786
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTTTAATTGATTCTATTACTCTGGTTTTCAGATCACCAGTATTTACT  799

seq1  TTCACCAGTATTTTCATCTTAGAATCTTTGAAGCCAGTTCAGTGTACATG  836
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCCAGTATTTTCATCTTAGAATCTTTGAAGCCAGTTCAGTGTACATG  849

seq1  ATTATTTTGTGTGTTGCAGGTTTTAATCCTGGCTTGAGCTTTTTCTGTAT  886
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  ATTATTTTGTGTGTTGCAGGTTTTAATCCTGGCTTGAGCTTGTTCTGTAT  899

seq1  CTTTACTTCT-CCACTTGTGATGCCCAATATTTCCTCTAGTTTTTGA  932
      |||||||||| |  |||||||||||||||||||||||||||||||||
seq2  CTTTACTTCTACGGCTTGTGATGCCCAATATTTCCTCTAGTTTTTGA  946