Top
IDMSMg01-231E14
Information of forward sequence (DDBJ: AG398152)
Chromosome 9 position(base) 58446226 - 58446923 strand -
Alignment
seq1: chr9_58446226_58446923
seq2: MSMg01-231E14.T7_50_747 (reverse)

seq1  CCGAGTGCTGGGATCAAAGGTGTGCACCACCACTCCCGGCAAGTAAAAAG  50
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  CCGAGTGCT-GGATCAAAGGTGTGCACCACCACTCCCGGCAAGTAAAAAG  49

seq1  TTTTTTCTTCGTGATATTATGTAGAATTTCGCTTTGTTAATTAAATACGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTCTTCGTGATATTATGTAGAATTTCGCTTTGTTAATTAAATACGC  99

seq1  CTTTAGAGTAAAAAGGATTTTTTAAAACTAGTAAGTAGAATTTTACTTAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAGAGTAAAAAGGATTTTTTAAAACTAGTAAGTAGAATTTTACTTAG  149

seq1  GTAAAAGTATATCTGAGGTGTTACAGTGTTAGAAATTGAGGATTTGGATT  200
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  GTAAAAGTATATCTGAGGTGTTACAGTGTTAGAAATTGAGGAATTGGATT  199

seq1  TTTTAATTGCAGAAATGGAGAACTCCTTTGCAAATTTACTCTAAAGCCTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAATTGCAGAAATGGAGAACTCCTTTGCAAATTTACTCTAAAGCCTT  249

seq1  TGGACAAGAATGTTTTATACCTTTGGTTCTTGATCTGCTTGGTCAGTCTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGACAAGAATGTTTTATACCTTTGGTTCTTGATCTGCTTGGTCAGTCTT  299

seq1  GATGCCTTCATGGACTGGGTCTTTGGCATATTTTTGCAAAGTTAGTGATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGCCTTCATGGACTGGGTCTTTGGCATATTTTTGCAAAGTTAGTGATT  349

seq1  AAAATACATATGTCATGACTGCACTGAGAACAAAAGGCTAAGACAAACCC  400
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATACGTATGTCATGACTGCACTGAGAACAAAAGGCTAAGACAAACCC  399

seq1  CTTTAAAGCTAAGGCAGAATCTATAAAATAGCATGGAAATAATCCCAGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAAAGCTAAGGCAGAATCTATAAAATAGCATGGAAATAATCCCAGTG  449

seq1  TAAATCGATTCAGTACATTTTGTTTTTAAGTTTGATGGTACCATAGATTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATCGATTCAGTACATTTTGTTTTTAAGTTTGATGGTACCATAGATTT  499

seq1  AATTTGAGGCCTTTACATGCTAGGTAAACACACCTACCTATCTGGCTTAT  550
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  AATTTGAGGCCTTTACATGCTAGGTAAACACCCCTACCTATCTGGCTTAT  549

seq1  ATCCTTCCACTCTCCCTCTTAATTGTTTTTAAATTTTAAAAACTATTTGG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTTCCACTCTCCCTCTTAATTGTTTTTAAATTTTAAAAACTATTTGG  599

seq1  AGTATGTGAGTGCTTCCTTGGGCTTGGG-CATGCCTCTGACTAGAGACAA  649
      |||||||||||||||||||||||||||| |||||||||||||||||||||
seq2  AGTATGTGAGTGCTTCCTTGGGCTTGGGACATGCCTCTGACTAGAGACAA  649

seq1  CATTATGGATGTCTCACCTATCTTACTGTGGGTTTTAGGTATTGAATTC  698
      ||||||||||||||||||||||||||||||||    |||||||||||||
seq2  CATTATGGATGTCTCACCTATCTTACTGTGGGGAAAAGGTATTGAATTC  698

Information of reverse sequence (DDBJ: AG398153)
Chromosome 12 position(base) 60093403 - 60093787 strand +
Alignment
seq1: chr12_60093403_60093787
seq2: MSMg01-231E14.TJ_542_712

seq1  GGCTGGAGAGATGGCTCAGCAGTTAAGAGCACTGACTGCTTGCTCTTTCA  50
      ||||||||||||||||||||||||||||||||||||    ||||||| ||
seq2  GGCTGGAGAGATGGCTCAGCAGTTAAGAGCACTGAC----TGCTCTTCCA  46

seq1  GAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCT  100
      |||| |||||||||||||| |||||||||| ||||||||| |||||    
seq2  GAGGGCCTGAGTTCAATTCTCAGCAACCACCTGGTGGCTCCCAACC----  92

seq1  GAAATGGGATCCAATGCCATCTTCTGGTGTGTCTGAAGAAAGTGACAGTG  150
                         |||||||||||||||||| | ||  ||||||
seq2  -------------------TCTTCTGGTGTGTCTGAAAACAGATACAGTG  123

seq1  TACTGAGTAC--TCACATACATACAATAAGTAAGTAAATCCTTTATTTAA  198
      ||     |||   |||||| ||| |||         || |||| |  |||
seq2  TA-----TACATACACATATATATAAT---------AAACCTTNAAATAA  159

seq1  AAAAAAAAAGCATTATTTAAAAAAAGAAAGCCGGGCGTGGTGGCGCACGC  248
       || || ||  |                                      
seq2  TAATAATAATAA--------------------------------------  171

seq1  CTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTTGA  298
                                                        
seq2  --------------------------------------------------  171

seq1  GGCCAGCCTGGTCTACAAAGTGAGTTCCAGAACAGCCAGGACTATACAGA  348
                                                        
seq2  --------------------------------------------------  171

seq1  GAAACCCTGTCTTGAAAAAAAATAATAATAATAATAA  385
                                           
seq2  -------------------------------------  171