Top
IDMSMg01-263F19
Information of forward sequence (DDBJ: AG405208)
Chromosome 12 position(base) 85878530 - 85879118 strand -
Alignment
seq1: chr12_85878530_85879118
seq2: MSMg01-263F19.T7_465_542 (reverse)

seq1  AGGGGAGTGGGGGGGGGGGGAGGGTATGGGGGACTTTTGGGATAGCATTG  50
                                                        
seq2  --------------------------------------------------  0

seq1  GAAATGTAATTGAGGAAAATACATAATTAAAAAAATATTAAAAAAAGGAA  100
                                                        
seq2  --------------------------------------------------  0

seq1  AATTTTAGTGCAACCATTGTTAATTCTACTTCTAGGTGTATGACCAATAG  150
                                                        
seq2  --------------------------------------------------  0

seq1  AAATAATTGTCCACCAGCAGACGCTGCAAGAATATTGGTAGTGCTGCCTT  200
                                                        
seq2  --------------------------------------------------  0

seq1  TAATCCCAGCACTAGGAGGCAGAGGCAGGTGGATCTCTGAGTTCAAGGCC  250
                                                        
seq2  --------------------------------------------------  0

seq1  AGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAA  300
                                                        
seq2  --------------------------------------------------  0

seq1  CACTGTCTCGGGGGCGGGGGGGGGGGGTATATTGGTAGCTACCTCATCCA  350
                                                        
seq2  --------------------------------------------------  0

seq1  TGCAAAAGCAAAAAACAAAAAAACAAAACAAAAGTGTCAAGCAAAAAGAA  400
                                                        
seq2  --------------------------------------------------  0

seq1  CAACTTTTCAAATCTTTTCTTGCATTTTTGTGTTGTGTGTGCGCCTGTGG  450
                                                        
seq2  --------------------------------------------------  0

seq1  TATGAAGAAGGGCACACACTAGGACTGTGCCTGATTGAAGTTCTGTAACA  500
                                                        
seq2  --------------------------------------------------  0

seq1  GTCTGCAGACATGCCCGCAGTCAGGGCAGCTGTGACTGGGGGTATTGTCT  550
                | |   | ||   |||  |  | ||  |||||    | | 
seq2  ----------AGG---GGAG---GGGGGGGGGGGA--GGGGGGGGGGGCG  32

seq1  AGAGAGGA--CACAGGATCGGGGGG-----GGGGGGGGGGGGGGGC  589
       | | |||    | ||   ||||||     ||||||||||||||||
seq2  GGGGGGGAGGGGCGGGGGGGGGGGGGAGGAGGGGGGGGGGGGGGGC  78

Information of reverse sequence (DDBJ: AG405209)
Chromosome 12 position(base) 30091252 - 30091663 strand +
Alignment
seq1: chr12_30091252_30091663
seq2: MSMg01-263F19.TJ_74_489

seq1  GAATTCTAGAAAACTCATACAAAAACAGTGGAATGCCAGT-AGTAGCCTC  49
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  GAATTCTAGAAAACTCATACAAAAACAGTGGAATGCCAGTAAGTAGCCTC  50

seq1  CCCGAACCATGAGCAAGTGTGGAAACTGGCGAGGAGTGGGTAAAAGGGAA  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGAACCATGAGCAAGTGTGGAAACTGGCGAGGAGTGGGTAAAAGGGAA  100

seq1  CTCCCATGGTAGGTAGATACATTCTAGAGCTCTGATATAGTGATGTTCCC  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCATGGTAGGTAGATACATTCTAGAGCTCTGATATAGTGATGTTCCC  150

seq1  ATGACTGCATACATTTGCCAAAATGTATTAAAGTATGCACTCACATGGGT  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACTGCATACATTTGCCAAAATGTATTAAAGTATGCACTCACATGGGT  200

seq1  GCATTTTACTTGGTCTATACAATTTATGTGTCAAATTAGACATAAAGAAA  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATTTTACTTGGTCTATACAATTTATGTGTCAAATTAGACATAAAGAAA  250

seq1  TTTTACTAGCTGAAAGGACTTACACCCCCACCCTTATAGAACAGACTTCC  299
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  TTTTACTAGCTGANAGGACTTACACCCCCACCCTTATAGAACAGACTTCC  300

seq1  ATTTTATTAGGGCTATATCTCCAGGGACAGATTCATTCATCTGTCCT-CA  348
      |||| |  ||| ||||||||||||||||||||||||||||||||||  | 
seq2  ATTTAACCAGGCCTATATCTCCAGGGACAGATTCATTCATCTGTCCNCCC  350

seq1  TGGTAGCTCGT-AGAAGGACCAGGCTCAGGTCACTCCTATATCCAGGGCT  397
       |  |  |||| | || ||| || |||||||||| | ||| |||| || |
seq2  CGNNACTTCGTAAAAAAGACAAGCCTCAGGTCACCCTTATTTCCANGGTT  400

seq1  CAGCA-TCTCCGTCCC  412
      ||  | ||||||||||
seq2  CAAAATTCTCCGTCCC  416