Top
IDMSMg01-340E05
Information of forward sequence (DDBJ: AG454345)
Chromosome 13 position(base) 80498802 - 80499225 strand -
Alignment
seq1: chr13_80498802_80499225
seq2: MSMg01-340E05.T7_193_399 (reverse)

seq1  AGAAGAGGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG  50
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG  50

seq1  AGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  AGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGA-  99

seq1  GGGGGGGGGGAGGAGGAGGAGGAGGAGGAGGACAGGGAGGGGAAGCAGGA  150
              |||||||||||| || ||||| |               | ||
seq2  --------GGAGGAGGAGGAAGAAGAGGAAG---------------AAGA  126

seq1  GGGAGACGGAGAAGAAGAAG-AGAAGGAGAAGGAGAAGAAGAAGGAGGAG  199
      || ||| | ||||||||||| ||||| ||||| ||||||||||| || ||
seq2  GGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG  176

seq1  GAGGGGAGGGGGGAAGGGGGAGGGGGGACAAGAAGAAGGAGAAGGAGAAG  249
       |          ||||             ||||||||| ||||| |||| 
seq2  AA----------GAAG-------------AAGAAGAAGAAGAAGAAGAA-  202

seq1  GAGGAAAAGGAGGAGGAGGAGGAGGAGGAGAAAGAGGAGGAGGAGGAGAA  299
      |||||                                             
seq2  GAGGA---------------------------------------------  207

seq1  GGAGATGAAGAAGAAGAAGAAGAGGAGGAGGAGGAGGAGAAGGAGGAGGA  349
                                                        
seq2  --------------------------------------------------  207

seq1  GAGGGAGTGGGAGGGGGAGGGGAAGGAGAGGGGAGGGGGAGGAGGAGGAC  399
                                                        
seq2  --------------------------------------------------  207

seq1  AACAAGAAGAAGAAGAAGAAGAGGA  424
                               
seq2  -------------------------  207

Information of reverse sequence (DDBJ: AG454346)
Chromosome 4 position(base) 32392367 - 32393036 strand -
Alignment
seq1: chr4_32392367_32393036
seq2: MSMg01-340E05.TJ_69_737 (reverse)

seq1  CTCACATTCCTGCTGTTGCTAGTCACCAGTGAACTGGAGTAGTCAGCATG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACATTCCTGCTGTTGCTAGTCACCAGTGAACTGGAGTAGTCAGCATG  50

seq1  CAGAAACAGCTTCAACTAGAACAAGCACAGCGCTCACAGTGTTGCTGATC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAACAGCTTCAACTAGAACAAGCACAGCGCTCACAGTGTTGCTGATC  100

seq1  AGACGCTCTGACGCTCACACCCCTCCACGTCCCTTCACGCTGCTCCGGTG  150
      |||| ||| |||||||||||||||||||||||||||||||||||||||||
seq2  AGACACTCCGACGCTCACACCCCTCCACGTCCCTTCACGCTGCTCCGGTG  150

seq1  ATTCCGCTGCGCTCTTACAGGGCCGCTTTGAGTTATTATGCTTGAAGGAA  200
      ||||||||||||| |||||||||||||||| ||| |||||||||||||||
seq2  ATTCCGCTGCGCTGTTACAGGGCCGCTTTG-GTTTTTATGCTTGAAGGAA  199

seq1  GAATGAGGACATTTTTGTGGCTGTTGTGCATTTTAGGAATCCCAGACTAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATGAGGACATTTTTGTGGCTGTTGTGCATTTTAGGAATCCCAGACTAC  249

seq1  ACAGCAGCGACATTATCATTATTTTGAAGTGGCTTTGTTTTAACCCTACT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  ACAGCAGCGACATTATCATTATTTTGAAGTGGCTTTGTTTTAACCCTACC  299

seq1  TTATAACATCGAGTCTTCCCTCTCCAGCAGGGCATCTCTTACCGCGTGGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATAACATCGAGTCTTCCCTCTCCAGCAGGGCATCTCTTACCGCGTGGC  349

seq1  TGATAGTTTGGACCAGGTAATAATTATGGAGAATGCACTATAGCTGAGAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATAGTTTGGACCAGGTAATAATTATGGAGAATGCACTATAGCTGAGAC  399

seq1  CTCACATCTTGAACCCCAAGCATGAAGTAGTGAGAGCAAACTGGAGGTAA  450
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  CTCACATCTTGAACCCCAAGTATGAAGTAGTGAGAGCAAACTGGAGGTAA  449

seq1  AGGAGGCCTTTTCATTTCAAAGCCTGCCCCAGTGATGTACTTCCTCCAAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGGCCTTTTCATTTCAAAGCCTGCCCCAGTGATGTACTTCCTCCAAC  499

seq1  AAGGCTGCACCGCCAGACCCTGGGGTCATTTTTTGTTCAAACCACAGCAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCTGCACCGCCAGACCCTGGGGTCATTTTTTGTTCAAACCACAGCAC  549

seq1  GCGCTGGATCTGTGCTTTACCACTGAGCTTGTAGTTTATAGGTAAACTCA  600
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTGGATCTGTGCTTTACCACTGAGCTTGTAGTTTATAGGTAAACTCA  599

seq1  GCATTTGAAATGGAAATATTAGGTATATAAAGTTTCCTACATAGCAAACA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATTTGAAATGGAAATATTAGGTATATAAAGTTTCCTACATAGCAAACA  649

seq1  AATGATTTTAGGGAGAATTC  670
      ||||||||||||||||||||
seq2  AATGATTTTAGGGAGAATTC  669