Top
IDMSMg01-387J02
Information of forward sequence (DDBJ: AG490270)
Chromosome 12 position(base) 24922925 - 24923345 strand +
Alignment
seq1: chr12_24922925_24923345
seq2: MSMg01-387J02.T7_46_466

seq1  AATTCATTTCCACAGTCCAAAACTCAGCTTGCAAGCTTTAAAATTCAAGA  50
      |||||||||||||| ||| |||||||||||| ||||||||||||||||||
seq2  AATTCATTTCCACATTCCCAAACTCAGCTTGTAAGCTTTAAAATTCAAGA  50

seq1  GCACACCTTCCCTTCTTCCCATGCCTAGTTGAGCATATCTTCAACACTTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACACCTTCCCTTCTTCCCATGCCTAGTTGAGCATATCTTCAACACTTC  100

seq1  CCAAGGCACCTTGTTCTGTTATAGCATGTGGTAGTTTAAATGTGAAATGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGGCACCTTGTTCTGTTATAGCATGTGGTAGTTTAAATGTGAAATGT  150

seq1  CTGCCAAAGACCCAAGTTTTGAAGAATTTTTTCTCTAGGTGTGGCCTGAG  200
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  CTGCCAAAGACCCAAGTTTTGAAGAATTTTTTCTCTACGTGTGGCCTGAG  200

seq1  GAAGAAAGTTAGACCATTGGGAGCATGCCTTTGAGGCACTGTTGGGACCT  250
      ||| ||||||| ||||||| ||||||||||  ||||||||||||| ||||
seq2  GAACAAAGTTACACCATTGCGAGCATGCCTCCGAGGCACTGTTGGCACCT  250

seq1  TGCTCTCCTTCCCCTCCCTGCTTCTCTGCCATGGTAAACCTGCTACATGC  300
      ||||| |||||||||||||||||||||| |||||||||||||||||||||
seq2  TGCTCCCCTTCCCCTCCCTGCTTCTCTGTCATGGTAAACCTGCTACATGC  300

seq1  TGCTACCATGATGCACTAAGTTGCTAGATGCCCAAATCTACTGGTGCTGG  350
      ||||||||||    |||||||||||| ||||||||  | |||| ||| ||
seq2  TGCTACCATGCATAACTAAGTTGCTATATGCCCAACCCCACTGCTGCCGG  350

seq1  GCCAAACAACCATGGACTGAAACCATGAGCCAAAAACTAACTCTTTCCTC  400
       ||  ||||||||||||||||| ||||| ||    |||||||||||||||
seq2  CCCCCACAACCATGGACTGAAATCATGATCCCCCCACTAACTCTTTCCTC  400

seq1  CTAAATTGATTCTTTCATTTC  421
      | | ||||||||  |||||||
seq2  CCATATTGATTCCCTCATTTC  421

Information of reverse sequence (DDBJ: AG490271)
Chromosome 12 position(base) 22935497 - 22935920 strand +
Alignment
seq1: chr12_22935497_22935920
seq2: MSMg01-387J02.TJ_81_504

seq1  GAATTCTTGCTGTGTGAGCTTGAGATCGGTGATTCTTTTCCCAGTACCAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTGCTGTGTGAGCTTGAGATCGGTGATTCTTTTCCCAGTACCAA  50

seq1  CATAAGCCAGGAGTGACTAGCTACATGCCCTGTAAGCCCAGCACTGTGGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAAGCCAGGAGTGACTAGCTACATGCCCTGTAAGCCCAGCACTGTGGT  100

seq1  GTGTGGAGACAGGAGGATCACTGGGAGCACTGGCCACCTGCCTAGCACCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGGAGACAGGAGGATCACTGGGAGCACTGGCCACCTGCCTAGCACCA  150

seq1  ACTTCAGCGAGATAACCCCCCTGCCTCATATATTAAAAAAGTAATTTTTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCAGCGAGATAACCCCCCTGCCTCATATATTAAAAAAGTAATTTTTA  200

seq1  GAAGTCCTTGATTGTAATGGCTTTTAAACCAAACTGAAAATGAAAAAGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGTCCTTGATTGTAATGGCTTTTAAACCAAACTGAAAATGAAAAAGAA  250

seq1  GAAAGGCAAATTTTTCTTCTCAGAAAGACACGGATGCTATTAGGACAGAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGGCAAATTTTTCTTCTCAGAAAGACACGGATGCTATTAGGACAGAC  300

seq1  ACACTGTGCTCACTTCAGCCAAGATCTTATTTCTAAATAAGACCACACAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACTGTGCTCACTTCAGCCAAGATCTTATTTCTAAATAAGACCACACAT  350

seq1  TGAGGCACTAGGGCCAACTTCTTCATAGCTCTTCTCTGGGGAATACAGGA  400
      |||||||||||||||||||||||||||||||||||||||| ||||| |||
seq2  TGAGGCACTAGGGCCAACTTCTTCATAGCTCTTCTCTGGGTAATACTGGA  400

seq1  TGTTAAATGATTTAGGGGTGTAAG  424
      ||||||||||||||||||||||||
seq2  TGTTAAATGATTTAGGGGTGTAAG  424