Top
IDMSMg01-395D06
Information of forward sequence (DDBJ: AG496077)
Chromosome 12 position(base) 22225338 - 22225874 strand +
Alignment
seq1: chr12_22225338_22225874
seq2: MSMg01-395D06.T7_54_591

seq1  GAATTCATTCCCACAGTCCAAAACTCAGCTTGCAAGGTTTAAAATTCAAG  50
      ||||||||||||    ||||||||||||||||||||||||||||||||||
seq2  GAATTCATTCCCTTTTTCCAAAACTCAGCTTGCAAGGTTTAAAATTCAAG  50

seq1  AGCACACCTTCCCTTCTTCCCATGCCTAGTTGAGCATATCTTCAACACTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACACCTTCCCTTCTTCCCATGCCTAGTTGAGCATATCTTCAACACTT  100

seq1  CTCAAGGCACCTTGTTCTGTTATAGCATGTGGTAGTTTAGATGTGAAATG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAAGGCACCTTGTTCTGTTATAGCATGTGGTAGTTTAGATGTGAAATG  150

seq1  TCTGCCAAAGACCCAAGTTTTGAAGAATTTTTCCTCTAGGTGTTGCCTGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCCAAAGACCCAAGTTTTGAAGAATTTTTCCTCTAGGTGTTGCCTGA  200

seq1  GGAAGAAAGTTAGATCATTGGGAGCATGTCTTTGAGGCACTGTTGGGAAC  250
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  GGAAGAAAGTTAGATCATTGGTAGCATGTCTTTGAGGCACTGTTGGGAAC  250

seq1  TTGCTCCCCTTCCCCTCCCTGCTTCTCTGCCATGGTAAACCTGCTACATG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTCCCCTTCCCCTCCCTGCTTCTCTGCCATGGTAAACCTGCTACATG  300

seq1  CTGCTACCATGATGTACTAAGTTGCCAGATGCCCAAATCTACTGGTGCTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTACCATGATGTACTAAGTTGCCAGATGCCCAAATCTACTGGTGCTG  350

seq1  GGCCAAGCAACCATGGACTGAAACCAAGAGCCAAAAACTAACTCTTTCCT  400
      ||||||||||||||||||||| | |||||| |||||||||||||||||||
seq2  GGCCAAGCAACCATGGACTGATATCAAGAGTCAAAAACTAACTCTTTCCT  400

seq1  CCTAAATTGATTCTTTCATTTCGTCACAGTGATGTAAAAGTAAGTGACAC  450
      ||||||||||||||||||||||| ||||||||||||||||||||||||| 
seq2  CCTAAATTGATTCTTTCATTTCGCCACAGTGATGTAAAAGTAAGTGACAT  450

seq1  ACAACACTTTCCACTCACAGGTCTGTCTTTGTCACTAGATGAGTTTGCTG  500
      |||||||||||||||| |||||||||||||||||||| ||||||||| ||
seq2  ACAACACTTTCCACTCTCAGGTCTGTCTTTGTCACTACATGAGTTTGTTG  500

seq1  CAGATCAGGTATATAA-TCCTTTCAGCTTTATGTCCCT  537
      || ||||||||||||| || ||||| ||  ||||||||
seq2  CATATCAGGTATATAATTCTTTTCACCTCCATGTCCCT  538

Information of reverse sequence (DDBJ: AG496078)
Chromosome 12 position(base) 23633325 - 23633744 strand +
Alignment
seq1: chr12_23633325_23633744
seq2: MSMg01-395D06.TJ_72_491

seq1  GAATTCTGATGTCACCTCTGTAATGCTCTGTCAGGACAGCCCCTGCTCTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGATGTCACCTCTGTAATGCTCTGTCAGGACAGCCCCTGCTCTC  50

seq1  AGGTGCCTGTGGGAATCTCTGGGGCATGTTTTCAGATCTTAAAAGATTCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGCCTGTGGGAATCTCTGGGGCATGTTTTCAGATCTTAAAAGATTCT  100

seq1  ATGCACACACACTGTTGAAGCTGAATCGCCTGGGAAGTCGCAGACTGAGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCACACACACTGTTGAAGCTGAATCGCCTGGGAAGTCGCAGACTGAGA  150

seq1  CGTCTTAGTTCCTGTTAAATGAATTATGGGTGCCCTTTAAAAGAGAACGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTCTTAGTTCCTGTTAAATGAATTATGGGTGCCCTTTAAAAGAGAACGA  200

seq1  AACAGACATGTTTTGATGGGAAAAACACATGAAGAATGCAGCTGCTTTTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAGACATGTTTTGATGGGAAAAACACATGAAGAATGCAGCTGCTTTTT  250

seq1  CCCAAACAGCCATCAGCCCATCTAATTTAGGCCAATGAGGGGAAACGCAC  300
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATACAGCCATCAGCCCATCTAATTTAGGCCAATGAGGGGAAACGCAC  300

seq1  CCAAAGCTCCCAGTTGACCTTCCCCATGAGAATCGTGTGTCCTGGTCCTG  350
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAAGCTCCCAGTTGACCTTCCCCATGAGAATCGTGTGTCCTGGTCCTG  350

seq1  GGCCCAGAGTGAGCGTGGGGGGTAAAGAGCCTGGCCCTGGTAGGAAAGGG  400
      ||||||||||||||   ||  |||||||| ||||||||||||  ||||  
seq2  GGCCCAGAGTGAGCTGTGGTTGTAAAGAGTCTGGCCCTGGTATCAAAGTT  400

seq1  AAACAGCTTCCCCAGGACTG  420
      |||||||||||||| |||||
seq2  AAACAGCTTCCCCATGACTG  420