Top
IDMSMg01-413L17
Information of forward sequence (DDBJ: AG510196)
Chromosome 12 position(base) 23929133 - 23929819 strand +
Alignment
seq1: chr12_23929133_23929819
seq2: MSMg01-413L17.T7_37_744

seq1  GAATTCTAAGCACTAGGTGCTAGGTCCTGTTAAGGAAGATGAGACATGCA  50
      ||||||||||||||| | ||||||||||||||||||||||||||||||||
seq2  GAATTCTAAGCACTATGCGCTAGGTCCTGTTAAGGAAGATGAGACATGCA  50

seq1  CTCAGTATTACCTGCTACCGCCCATCTTCTTCACCTCTTTCCCAGGATGT  100
      ||||||||||||||||||| ||| ||||||||||||||||||||||||||
seq2  CTCAGTATTACCTGCTACCACCCGTCTTCTTCACCTCTTTCCCAGGATGT  100

seq1  TAGTGCTCTATGTACATATTTTATTTATTTATCTACAGGACTAGGAGATA  150
      |||||||||||||||||||    |||||||||||||||||||||||||||
seq2  TAGTGCTCTATGTACATAT----TTTATTTATCTACAGGACTAGGAGATA  146

seq1  TTTAAAGTTCCTTGTCCAACACAGACATATGGCACCTTGATATTGCCTTT  200
      |||||||||||||||||||||||||| ||||||| |||||||||||||||
seq2  TTTAAAGTTCCTTGTCCAACACAGACGTATGGCAGCTTGATATTGCCTTT  196

seq1  CAAAGCACACATTTACTTATCTAAACATGTCCTCCCCTGTACAAACAACC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGCACACATTTACTTATCTAAACATGTCCTCCCCTGTACAAACAACC  246

seq1  AACTCAAATGTCCACAGTATCTTGATCAGAAATAATCATCAACTCAGGTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCAAATGTCCACAGTATCTTGATCAGAAATAATCATCAACTCAGGTA  296

seq1  TCCAGGTGCCACACATCTGTAATTCCAGAACGGGAAAGTAGAGGCAGGAT  350
       ||||||||||||||||||||||||||||||||||  |||||||||||||
seq2  GCCAGGTGCCACACATCTGTAATTCCAGAACGGGAGGGTAGAGGCAGGAT  346

seq1  TATCAGGAGTTCAAGGTCATCTATGACTATATTGCAAGTTCATGACCAGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCAGGAGTTCAAGGTCATCTATGACTATATTGCAAGTTCATGACCAGC  396

seq1  CTGAGCTACATGAGACCCTGTCTAAAAAAGTTATATTAAAAGAAAGAAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGCTACATGAGACCCTGTCTAAAAAAGTTATATTAAAAGAAAGAAAA  446

seq1  CAGGAAGGCCAGTAGTGGTGCATGCCTTTAACCCCAGCACTCAGTGACAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAAGGCCAGTAGTGGTGCATGCCTTTAACCCCAGCACTCAGTGACAG  496

seq1  TGCAGACAGATAGGAGTTCAAGGAAGGCTACCCTGGGCTACAGAACAAGT  550
      |||||| |||||||| ||||||||||||||||||||||||||||||||||
seq2  TGCAGAAAGATAGGAATTCAAGGAAGGCTACCCTGGGCTACAGAACAAGT  546

seq1  TCTTGATAGCCAGGACTACACAGACAAACACTCTCTCTCTCTCAAAGACA  600
      |||||||||||||||||||||||| ||||||| |||||||||||||||||
seq2  TCTTGATAGCCAGGACTACACAGAGAAACACTGTCTCTCTCTCAAAGACA  596

seq1  TACACAGAAACACACACACACA----------TACACAC----AGAAAGA  636
      ||||| ||||||| ||||| ||          ||||| |    |||   |
seq2  TACACTGAAACACTCACACCCACTCTACTTCTTACACCCGGTGAGAGGTA  646

seq1  GAGAGAGAGA-AACCGAGAAAC----------AGAGACAGAGAGATCTAC  675
      || ||||||| |||||||||||          |||||  |||||||||||
seq2  GATAGAGAGAGAACCGAGAAACAGAGTCTGAGAGAGATTGAGAGATCTAC  696

seq1  AAATGGAAGATT  687
        ||||||||||
seq2  CTATGGAAGATT  708

Information of reverse sequence (DDBJ: AG510197)
Chromosome 12 position(base) 19427264 - 19427880 strand -
Alignment
seq1: chr12_19427264_19427880
seq2: MSMg01-413L17.TJ_57_674 (reverse)

seq1  AAGAACAAG-AAGCCTTACTTGGGACCC-CAT-AGCTGGCTTGCTGTCCA  47
      ||||||||| || ||||||||||||||| ||| |||||||||||||||||
seq2  AAGAACAAGAAACCCTTACTTGGGACCCACATAAGCTGGCTTGCTGTCCA  50

seq1  AAAGGAGGGACAACAGCATTTGGCCAGTGAACAGCCCTTAGTGTGACACA  97
      ||||||||| |||||||||| | |||||||||||||||||||||||||||
seq2  AAAGGAGGGCCAACAGCATTGGCCCAGTGAACAGCCCTTAGTGTGACACA  100

seq1  TTCCTGAGTGTCTATTCTACTGTCACTATTGTGCCAGAATGGAGTTTTCT  147
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTGAGTGTCTATTCTACTGTCACTATTGTGCCAGAATGGAGTTTTCT  150

seq1  AGAAGACTAATTCACCCACATCCCTCACATTCCTTCCTGAGTCCTTAACC  197
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  AGAAGACTAATTCACCCACATCCCTCACATTCCTTCCTGAGTCCCTAACC  200

seq1  CTGGAGGTCACAAAGTGTTTGAGCCTCCAGGATAGGAAGGGTCTCTTGGG  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGAGGTCACAAAGTGTTTGAGCCTCCAGGATAGGAAGGGTCTCTTGGG  250

seq1  CCTCTGAAATGTCATGTAGCCCTAATTTACAGTTATCAAACAGTGTGTGT  297
      |||||||||||||||||||||||||||||||||||||||||  |||||||
seq2  CCTCTGAAATGTCATGTAGCCCTAATTTACAGTTATCAAAC--TGTGTGT  298

seq1  ACCCTGCCCTGTTTGGGGGCACTGTGGGGGTCTCACGGTGGTAAACTATT  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTGCCCTGTTTGGGGGCACTGTGGGGGTCTCACGGTGGTAAACTATT  348

seq1  AAATACAGAAATGCAGGAAGCCACAGTCTGAGAAGTGGAGTGCTCCCTGT  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATACAGAAATGCAGGAAGCCACAGTCTGAGAAGTGGAGTGCTCCCTGT  398

seq1  ATGTAAAACTGCCACATATGTCCTTGTTGGCTGTGACCCTGACACTGTGG  447
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  ATGTAAAACTCCCACATATGTCCTTGTTGGCTGTGACCCTGACACTGTGG  448

seq1  GATAGAGACAACAGGAACCAATTCTAGGGTAGTTCTGGCCAGCTAGTCTA  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAGAGACAACAGGAACCAATTCTAGGGTAGTTCTGGCCAGCTAGTCTA  498

seq1  GACAAAATGGTAAGTAGTACTCTCTGGGTTAATTGAGAGGCCCTGACTCA  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAAAATGGTAAGTAGTACTCTCTGGGTTAATTGAGAGGCCCTGACTCA  548

seq1  AAAATAAGGGCTAGACTCTGAGGCCTGTAGACCTGGCTCTGCGCTTACAA  597
      |||||| |||| ||||||||||||||||||||||||||||||||||||||
seq2  AAAATAGGGGCAAGACTCTGAGGCCTGTAGACCTGGCTCTGCGCTTACAA  598

seq1  ACAACTAATACTGTGAATTC  617
      ||||||||||||||||||||
seq2  ACAACTAATACTGTGAATTC  618