Top
IDMSMg01-421F07
Information of forward sequence (DDBJ: AG515983)
Chromosome 13 position(base) 105012852 - 105012894 strand -
Alignment
seq1: chr13_105012852_105012894
seq2: MSMg01-421F07.T7_375_417 (reverse)

seq1  ACACAGACACACACACACAGACACACACACACACACACACAGA  43
      ||||| ||||||||||||| |||||||||||||||||||||||
seq2  ACACACACACACACACACACACACACACACACACACACACAGA  43

Information of reverse sequence (DDBJ: AG515984)
Chromosome 9 position(base) 27153115 - 27153676 strand +
Alignment
seq1: chr9_27153115_27153676
seq2: MSMg01-421F07.TJ_67_628

seq1  GAATTCATAGAAGAGAAAATACCTACCTTACTCCGTTGACTCCAGACTGG  50
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  GAATTCATAGAAGAGAAAATACTTACCTTACTCCGTTGACTCCAGACTGG  50

seq1  GTTTTTGGTTGTTCCAGTGGGGAAAGAGCAGGTTCTCTGCAGAAGTTTGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTTGGTTGTTCCAGTGGGGAAAGAGCAGGTTCTCTGCAGAAGTTTGG  100

seq1  CCCTGGAGCCCATACGTACAGATGCTCCCTTGGTTTCAGTGGCAACTTGG  150
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  CCCTGGAGCCCATACATACAGATGCTCCCTTGGTTTCAGTGGCAACTTGG  150

seq1  ACTTCAGCCCTGGGAGATGCATGGAGCGTGCAAGGCTCTGAGTCCCCTTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCAGCCCTGGGAGATGCATGGAGCGTGCAAGGCTCTGAGTCCCCTTC  200

seq1  TCACTCCGTTTTCCTTATGTGTCTGTCTCCTTCTCTCTAGACGGTTCTGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTCCGTTTTCCTTATGTGTCTGTCTCCTTCTCTCTAGACGGTTCTGC  250

seq1  CTCCCAGGCTCAGCAGCTTCCCAGCTCTCAGGTTCTGTGGCCCGACGAAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCAGGCTCAGCAGCTTCCCAGCTCTCAGGTTCTGTGGCCCGACGAAG  300

seq1  CTGTCTGCCTCCGCAAGAAGAAGAGACACTCTCGTCCTGATCCCTTTGCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCTGCCTCCGCAAGAAGAAGAGACACTCTCGTCCTGATCCCTTTGCC  350

seq1  CGGCTCTCAGACTTGTGCCACCGTCAGCTTCCGGAAGACCAGACAGCAAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCTCTCAGACTTGTGCCACCGTCAGCTTCCGGAAGACCAGACAGCAAT  400

seq1  CCTCAACAGCGTGGATCATGATGACCCAGGCCACGCTACTCTGCTATGAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCAACAGCGTGGATCATGATGACCCAGGCCACGCTACTCTGCTATGAC  450

seq1  GTGACATCACTCTAAATGTCCCCAGGGTGGGGTGCTAGGCTAAAGGGGTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGACATCACTCTAAATGTCCCCAGGGTGGGGTGCTAGGCTAAAGGGGTG  500

seq1  GAGAGGGACCATTGTACAGGGCCCTGTCCTCCTCTGCCTATCATGGGATG  550
      ||||||||||||||||||||| ||||||||||||||||||||||| ||||
seq2  GAGAGGGACCATTGTACAGGGGCCTGTCCTCCTCTGCCTATCATGNGATG  550

seq1  GCTCAGGCCCTT  562
      ||||||||||||
seq2  GCTCAGGCCCTT  562